Detecting SARS-CoV-2 with Quantitative RT PCR - Evaluating primers

Evaluate primer sequences from the UW publication - this is similar to an activity in Dr. Porter's bioinformatics course (Bioinformatics for Biology and Biotech:  Learning guide 10. PCR and primer BLAST)

Before you begin:  Go to the bottom of this page and download the worksheet. top

1.  Pick a pair of primers and their corresponding probe to investigate from  Table 1 below. There are 14 sets of primers (forward and reverse) and probe sets.  

A.   Only use the negative controls if you want to confirm that they should be negative.  These are at the bottom of Table 1.

B.  Please note - some primers have unusual letters like S or Y or R. 

 Letters like S, Y, R, W, and some others are used to represent different combinations of nucleotides (see below).  If you were operating an oligonucleotide synthesis machine, you could use these letters to program the machine and make oligonucleotides with different bases at a specific position.  Having a mixture of oligonucleotides with different bases at a position can help you avoid problems that might come from mutations or polymorphisms in your target sequence. For example, R stands for purine.  If you ordered oligonucleotide primers or you make primers, and your sequence contained an R, say at position 5, then about half of your oligonucleotides would contain an Adenine and the other half would have Guanine.  The composition wouldn't be exactly half and half because one base can be added more efficiently than the other, but it would be close enough.  

2.  Go to nucleotide blast at the NCBI.

3.  Paste your forward primer in the search box. 

4.  Type about 20 N's. An example sequence is shown below.

GTGARATGGTCATGTGTGGCGGNNNNNNNNNNNNNNNNNNNNCARATGTTAAASACACTATTAGCATA

5.  Paste the reverse primer at the end.

6.  Replace any unusual letters with an N as shown in the example below.

GTGANATGGTCATGTGTGGCGGNNNNNNNNNNNNNNNNNNNNCANATGTTAAANACACTATTAGCATA

7.  Select the Betacoronavirus database.

8.  Choose blastn as your algorithm.

9.  Click Algorithm parameters.

10.  Make sure the Word size is set to 11.

11.  Unclick all  Filters - i.e. low complexity regions, masking, etc.

12.  Click BLAST.

If your primer sequences are correct, they should both bind to the SARS-CoV-2 virus.

13.  Click the Alignments tab to see where the primers bind.

14.  Draw a map to show how the primers bind to the SARS-CoV-2 template and use the values to determine the size of the PCR product.  Remember one primer is a Reverse primer.  

15.  Click the Graphics link to see where the probe binds relative to the primers as shown in the video below.

Note:  when you search for the probe binding site, just use the sequence.  Do not include the dye or the quencher.  Here's an example:  CAGGTGGAACCTCATCAGGAGATGC

Check the following things:

A.  Does the probe bind to the template?

B.  The primer binding sites should not interfere with the probe binding to the template.

Hand in the items below.  Alternatively, download and complete the worksheet at the bottom of this page.

1.  A map showing the SARS-CoV-2 genome and where your primer sequences and probe bind. Your map should include the nucleotide positions from the SARS-CoV-2 genome, and should show the 5' and ends of each primer.

2.  Give the size of the PCR product.  Include the units.

3.  A screen captured image from the NCBI showing the same information.

MATERIALS AND REFERENCES

SARS-CoV-2 genome from the NCBI

Accession number for the SARS-CoV-2 reference sequence:   ref|NC_045512

Table 1Table 1. Probe and primer sets from Nalla et. al. (1).

Negative controls:  EXO and RNAseP have no homology with SARS-CoV2 sequences.

FAM: 6-carboxyfluorescein

VIC: 2′-chloro-7′phenyl-1,4-dichloro-6-carboxy-fluorescein

BHQ1: Black Hole Quencher-1

MGB: Minor Grove Binder
 

References:

1.  Nalla AK, Casto AM, Huang MW, Perchetti GA, Sampoleo R, Shrestha L, Wei Y, Zhu H, Jerome KR, Greninger AL. Comparative Performance of SARS-CoV-2 Detection Assays Using Seven Different Primer/Probe Sets and One Assay Kit. J Clin Microbiol. 2020 Apr 8:JCM.00557-20. doi: 10.1128/JCM.00557-20. Epub ahead of print. PMID: 32269100.

2.  Yu Jin Jung, Gun-Soo Park, Jun Hye Moon, Keunbon Ku, Seung-Hwa Beak, Seil Kim, Edmond Changkyun Park, Daeui Park, Jong-Hwan Lee, Cheol Woo Byeon, Joong Jin Lee, Jin-Soo Maeng, Seong Jun Kim, Seung Il Kim, Bum-Tae Kim, Min Jun Lee, Hong Gi Kim.  Comparative analysis of primer-probe sets for the laboratory confirmation of SARS-CoV-2 bioRxiv 2020.02.25.964775; doi: https://doi.org/10.1101/2020.02.25.964775

Return to the top of the page bottom